Help
Input: User has to supply the miRNA sequences in FASTA format. Each sequence should contain ony the standard nucleotides i.e., A, U, G and C. An example of two sequences is given below.
>MIMAT0000793_Rattus_norvegicus_Axon;Cytoplasm
AUCACAUUGCCAGGGAUUACC
>MIMAT0000794_Rattus_norvegicus_Axon;Cytoplasm;Nucleus
UGGCUCAGUUCAGCAGGAACAG
Output: The result shows the probabilities with which each sequence is predicted in eight different localizations. For the first sequence, the result is as follows, where the values inside brackets represent probabilities.
